Genome Browser User Guide
Contents
Browse
the Genome Browser mailing list.
See also the Open Helix tutorial and training
materials.
Questions and feedback are welcome.
What does the Genome Browser do?
As vertebrate genome sequences near completion and research re-focuses on their analysis, the issue
of effective sequence display becomes critical: it is not helpful to have 3 billion letters of
genomic DNA shown as plain text! As an alternative, the UCSC Genome Browser provides a rapid and
reliable display of any requested portion of genomes at any scale, together with dozens of aligned
annotation tracks (known genes, predicted genes, ESTs, mRNAs, CpG islands, assembly gaps and
coverage, chromosomal bands, mouse homologies, and more). Half of the annotation tracks are computed
at UCSC from publicly available sequence data. The remaining tracks are provided by collaborators
worldwide. Users can also add their own custom tracks to the browser for educational or research
purposes.
The Genome Browser stacks annotation tracks beneath genome coordinate positions, allowing rapid
visual correlation of different types of information. The user can look at a whole chromosome to
get a feel for gene density, open a specific cytogenetic band to see a positionally mapped disease
gene candidate, or zoom in to a particular gene to view its spliced ESTs and possible alternative
splicing. The Genome Browser itself does not draw conclusions; rather, it collates all relevant
information in one location, leaving the exploration and interpretation to the user.
The Genome Browser supports text and sequence based searches that provide quick, precise access to
any region of specific interest. Secondary links from individual entries within annotation tracks
lead to sequence details and supplementary off-site databases. To control information overload,
tracks need not be displayed in full. Tracks can be hidden, collapsed into a condensed or
single-line display, or filtered according to the user's criteria. Zooming and scrolling controls
help to narrow or broaden the displayed chromosomal range to focus on the exact region of interest.
Clicking on an individual item within a track opens a details page containing a summary of
properties and links to off-site repositories such as PubMed, GenBank, Entrez, and OMIM. The page
provides item-specific information on position, cytoband, strand, data source, and encoded protein,
mRNA, genomic sequence and alignment, as appropriate to the nature of the track.
A blue navigation bar at the top of the browser provides links to several other tools and data
sources. For instance, under the "View" menu, the "DNA" link enables the user
to view the raw genomic DNA sequence for the coordinate range displayed in the browser window. This
DNA can encode track features via elaborate text formatting options. Other links tie the Genome
Browser to the BLAT alignment tool, provide access to the underlying relational database via the
Table Browser, convert coordinates across different assembly dates, and open the window at the
complementary Ensembl or
NCBI Map Viewer annotation.
The browser data represents an immense collaborative effort involving
thousands of people from the international biomedical research community. The UCSC Bioinformatics
Group itself does no sequencing. Although it creates the majority of the annotation tracks in-house,
the annotations are based on publicly available data contributed by many labs and research groups
throughout the world. Several of the Genome Browser annotations are generated in collaboration with
outside individuals or are contributed wholly by external research groups. UCSC's other major roles
include building genome assemblies, creating the Genome Browser work environment, and serving it
online. The majority of the sequence data, annotation tracks, and even software are in the public
domain and are available for anyone to download.
In addition to the Genome Browser, the UCSC Genome Bioinformatics group provides several other tools
for viewing and interpreting genome data:
-
BLAT - a fast sequence-alignment tool similar
to BLAST. Read more.
-
Table Browser - convenient text-based access to the
database underlying the Genome Browser. Read more.
-
Genome Graphs - a tool that allows you to upload and display
genome-wide data sets such as the results of genome-wide SNP association studies, linkage studies
and homozygosity mapping. Read more.
-
Gene Sorter - expression, homology, and other information on
groups of genes that can be related in many ways. Read more.
Getting started: Genome Browser gateway
The UCSC Genome Bioinformatics home page provides
access to Genome Browsers on several different genome assemblies. To get started, click the Browser
link on the blue sidebar. This will take you to a Gateway page where you can select which genome to
display. Note that there are also official mirror sites in Europe and
Asia for users who are geographically closer to those continents than to the western United
States.
Opening the Genome Browser at a specific position
To get oriented in using the Genome Browser, try viewing a gene or region of the genome with which
you are already familiar, or use the default position. To open the Genome Browser window:
-
Select the clade, genome and assembly that you wish to display from the corresponding pull-down
menus. Assemblies are typically named by the first three characters of an organism's genus and
species names. For older assemblies that are no longer available from the menu, the data may still
be available on our Downloads page.
-
Specify the genome location you'd like the Genome Browser to open to. To select a location, enter
a valid position query in the search term text box at the top of the Gateway page or
accept the default position already displayed. The search supports several different types of
queries: gene symbols, mRNA or EST accession numbers, chromosome bands,
descriptive terms likely to occur in GenBank text, or specific chromosomal ranges.
-
Click the submit button to open up the Genome Browser window to the requested location.
In cases where a specific term (accession, gene name, etc.) was queried, the item will be
highlighted in the display.
Occasionally the Gateway page returns a list of several matches in response to a search, rather than
immediately displaying the Genome Browser window. When this occurs, click on the item in which
you're interested and the Genome Browser will open to that location.
The search mechanism is not a site-wide search engine. Instead, it primarily searches GenBank mRNA
records whose text annotations can include gene names, gene symbols, journal title words, author
names, and RefSeq mRNAs. Searches on other selected identifiers, such as NP and NM accession
numbers, OMIM identifiers, and Entrez Gene IDs are supported. However, some types of queries will
return an error, e.g. post-assembly GenBank entries, withdrawn gene names, and abandoned synonyms.
If your initial query is unsuccessful, try entering a different related term that may produce the
same location. For example, if a query on a gene symbol produces no results, try entering an mRNA
accession, gene ID number, or descriptive words associated with the gene.
Finding a genome location using BLAT
If you have genomic, mRNA, or protein sequence, but don't know the name or the location to which it
maps in the genome, the BLAT tool will rapidly locate the
position by homology alignment, provided that the region has been sequenced. This search will find
close members of the gene family, as well as assembly duplication artifacts. An entire set of query
sequences can be looked up simultaneously when provided in fasta format.
A successful BLAT search returns a list of one or more genome locations that match the input
sequence. To view one of the alignments in the Genome Browser, click the browser link for
the match. The details link can be used to preview the alignment to determine if it is of
sufficient match quality to merit viewing in the Genome Browser. If too many BLAT hits occur, try
narrowing the search by filtering the sequence in slow mode with
RepeatMasker, then rerunning the BLAT
search.
For more information on conducting and fine-tuning BLAT searches, refer to the
BLAT section of this document.
Opening the Genome Browser with a custom annotation track
You can open the Genome Browser window with a custom annotation track displayed by using the Add
Custom Tracks feature available from the gateway and annotation tracks pages. For more information
on creating and using custom annotation tracks, refer to the Creating
custom annotation tracks section.
Annotation track data can be entered in one of three ways:
-
Enter the file name for an annotation track source file in the Annotation File text box.
-
Type or paste the annotation track data into the large text box.
-
If the annotation data are accessible through a URL, enter the URL name in the large text
box.
Once you've entered the annotation information, click the submit button at the top of
the Gateway page to open up the Genome Browser with the annotation track displayed.
The Genome Browser also provides a collection of custom annotation tracks contributed by the UCSC Genome
Bioinformatics group and the research community.
NOTE: If an annotation track does not display correctly when you attempt to upload
it, you may need to reset the Genome Browser to its default settings, then reload the track. For
information on troubleshooting display problems with custom annotation tracks, refer to the
troubleshooting section in the Creating custom annotation tracks
section.
Viewing genome data as text
The Table Browser, a portal to the underlying
open source MySQL relational database driving the
Genome Browser, displays genomic data as columns of text rather than as graphical tracks. For more
information on using the Table Browser, see the section Getting started: on
the Table Browser.
Opening the Genome Browser from external gateways
Several external gateways provide direct links into the Genome Browser. Examples include:
Entrez Gene,
AceView,
Ensembl,
SuperFamily, and
GeneCards. Journal articles can also link
to the browser and provide custom tracks. Be sure to use the assembly date appropriate to the
provided coordinates when using data from a journal source.
Tips for Use
To facilitate your return to regions of interest within the Genome Browser, save the coordinate
range or bookmark the page of displays that you plan to revisit or wish to share with others.
It is usually best to work with the most recent assembly even though a full set of tracks might not
yet be ready. Be aware that the coordinates of a given feature on an unfinished chromosome may
change from one assembly to the next as gaps are filled, artifactual duplications are reduced, and
strand orientations are corrected. The Genome Browser offers multiple tools that can correctly
convert coordinates between different assembly releases. For more information on conversion tools,
see the section Converting data between assemblies.
To ensure uninterrupted browser services for your research during UCSC server maintenance and power
outages, bookmark a mirror site that replicates the
UCSC genome browser.
Bear in mind that the Genome Browser cannot outperform the underlying quality of the draft genome.
Assembly errors and sequence gaps may still occur well into the sequencing process due to regions
that are intrinsically difficult to sequence. Artifactual duplications arise as unavoidable
compromises during a build, causing misleading matches in genome coordinates found by alignment.
Interpreting and fine-tuning the Genome Browser display
The Genome Browser annotation tracks page displays a genome location specified through a Gateway
search, a BLAT search, or an uploaded custom annotation track. There are five main features on this
page: a set of navigation controls, a chromosome ideogram, the annotations tracks
image, display configuration buttons, and a set of track
display controls.
The first time you open the Genome Browser, it will use the application default values to configure
the annotation tracks display. By manipulating the navigation, configuration and display controls,
you can customize the annotation tracks display to suit your needs. For a complete description of
the annotation tracks available in all assembly versions supported by the Genome Browser, see the
Annotation Track Descriptions section.
The Genome Browser retains user preferences from session to session within the same web browser,
although it never monitors or records user activities or submitted data. To restore the default
settings, click the "Click here to reset" link on the Genome Browser Gateway page. To
return the display to the default set of tracks (but retain custom tracks and other configured
Genome Browser settings), click the default tracks button on the Genome Browser page.
Annotation track display conventions
Annotation track descriptions: Each annotation track has an associated
description page that contains a discussion of the track, the methods used to create the
annotation, the data sources and credits for the track, and (in some cases) filter and
configuration options to fine-tune the information displayed in the track. To view the description
page, click on the mini-button to the left of a displayed track or on the label for the track in
the Track Controls section.
Annotation track details pages: When an annotation track is displayed in full,
pack, or squish mode, each line item within the track has an associated details page that can be
displayed by clicking on the item or its label. The information contained in the details page
varies by annotation track, but may include basic position information about the item, related
links to outside sites and databases, links to genomic alignments, or links to corresponding mRNA,
genomic, and protein sequences.
Gene prediction tracks: Coding exons are represented by
blocks connected by horizontal lines representing introns. The 5' and 3' untranslated regions
(UTRs) are displayed as thinner blocks on the leading and trailing ends of the aligning regions.
In full display mode, arrowheads on the connecting intron lines indicate the direction of
transcription. In situations where no intron is visible (e.g. single-exon genes, extremely
zoomed-in displays), the arrowheads are displayed on the exon block itself.
Pattern Space Layout (PSL) alignment tracks: Aligning
regions (usually exons when the query is cDNA) are shown as black blocks. In dense display mode,
the degree of darkness corresponds to the number of features aligning to the region or the degree
of quality of the match. In pack or full display mode, the aligning regions are connected by lines
representing gaps in the alignment (typically spliced-out introns), with arrowheads indicating
the orientation of the alignment, pointing right if the query sequence was aligned to the forward
strand of the genome and left if aligned to the reverse strand. Two parallel lines are drawn over
double-sided alignment gaps, which skip over unalignable sequence in both target and query. For
alignments of ESTs, the arrows may be reversed to show the apparent direction of transcription
deduced from splice junction sequences. In situations where no gap lines are visible, the
arrowheads are displayed on the block itself. To prevent display problems, the Genome Browser
imposes an upper limit on the number of alignments that can be viewed simultaneously within the
tracks image. When this limit is exceeded, the Browser displays the best several hundred
alignments in a condensed display mode, then lists the number of undisplayed alignments in the
last row of the track. In this situation, try zooming in to display more entries or to return the
track to full display mode. For some PSL tracks, extra
coloring to indicate mismatching bases and query-only gaps may be available.
Chain tracks (2-species alignment): Chain tracks
display boxes joined together by either single or double lines. The boxes represent aligning
regions. Single lines indicate gaps that are largely due to a deletion in the genome of the first
species or an insertion in the genome of the second species. Double lines represent more complex
gaps that involve substantial sequence in both species. This may result from inversions,
overlapping deletions, an abundance of local mutation, or an unsequenced gap in one species. In
cases where there are multiple chains over a particular portion of the genome, chains with
single-lined gaps are often due to processed pseudogenes, while chains with double-lined gaps are
more often due to paralogs and unprocessed pseudogenes. In the fuller display modes, the
individual feature names indicate the chromosome, strand, and location (in thousands) of the match
for each matching alignment.
Net tracks (2-species alignment): Boxes represent
ungapped alignments, while lines represent gaps. Clicking on a box displays detailed information
about the chain as a whole, while clicking on a line shows information on the gap. The detailed
information is useful in determining the cause of the gap or, for lower level chains, the genomic
rearrangement. Individual items in the display are categorized as one of four types (other than
gap):
-
Top - The best, longest match. Displayed on level 1.
-
Syn - Lineups on the same chromosome as the gap in the level above it.
-
Inv - A lineup on the same chromosome as the gap above it, but in the opposite
orientation.
-
NonSyn - A match to a chromosome different from the gap in the level above.
Snake tracks: The snake alignment track (or snake
track) shows the relationship between the chosen Browser genome (reference genome) and another
genome (query genome). A snake is a way of viewing a set of pairwise gapless alignments that may
overlap on both the reference and query genomes. Alignments are always represented as being on the
positive strand of the reference species, but can be on either strand on the query sequence.
In full display mode, a snake track can be decomposed into two drawing elements: segments (colored
rectangles) and adjacencies (lines connecting the segments). Segments represent subsequences of
the target genome aligned to the given portion of the reference genome. Adjacencies represent the
covalent bonds between the aligned subsequences of the target genome.
Red tick-marks within segments represent substitutions with respect to the reference, shown in
windows of the reference of (by default) up to 50 Kb. Zoomed in to the base level, these
substitutions are labeled with the non-reference base.
An insertion in the reference relative to the query creates a gap between abutting segment sides
that is connected by an adjacency. An insertion in the query relative to the reference is
represented by an orange tick-mark that splits a segment at the location the extra bases would be
inserted. Simultaneous independent insertions in both query and reference look like an insertion
in the reference relative to the target, except that the corresponding adjacency connecting the
two segments is colored orange. More complex structural rearrangements create adjacencies that
connect the sides of non-abutting segments in a natural fashion.
Pack mode can be used to display a larger number of snake tracks in the limited vertical browser.
This mode eliminates the adjacencies from the display and forces the segments onto as few rows as
possible, given the constraint of still showing duplications in the query sequence.
Dense mode further eliminates these duplications so that each snake track is compactly represented
along just one row.
Wiggle tracks: These tracks plot a continuous function along a chromosome. Data
is displayed in windows of a set number of base pairs in width. The score for each window displays
as "mountain ranges" The display characteristics vary among the tracks in this group.
See the individual track descriptions for more information on interpreting the display. If the
peak is taller or shorter than what can be shown in the display, it is clipped and colored
magenta.
Annotation track display modes
Each annotation track within the window may have up to five display modes:
-
Hide: the track is not displayed at all. To hide all the annotation tracks, click
the hide all button. This mode is useful for restricting the display to only those tracks
in which you are interested. For example, someone who is not interested in SNPs or mouse synteny
may want to hide these tracks to reduce track clutter and improve speed. There are a few
annotation tracks that pertain only to one specific chromosome, e.g. Sanger22, Rosetta. In these
cases, the track and its associated controller will be hidden automatically when the track window
is not open to the relevant chromosome.
-
Dense: the track is displayed with all features collapsed into a single line.
This mode is useful for reducing the amount of space used by a track when you don't need
individual line item details or when you just want to get an overall view of an annotation. For
example, by opening an entire chromosome and setting the RefSeq Genes track to dense, you can get
a feel for the known gene density of the chromosome without displaying excessive detail.
-
Full: the track is displayed with each annotation feature on a separate line. It
is recommended that you use this option sparingly, due to the large number of individual track
items that may potentially align at the selected position. For example, hundreds of ESTs might
align with a specified gene. When the number of lines within a requested track location exceeds
250, the track automatically defaults to a more tightly-packed display mode. In this situation,
you can restore the track display to full mode by narrowing the chromosomal range displayed or by
using a track filter to reduce the number of items displayed. On tracks that contain only hide,
dense, and full modes, you can toggle between full and dense display modes by clicking on the
track's center label.
-
Squish: the track is displayed with each annotation feature shown separately, but
at 50% the height of full mode. Features are unlabeled, and more than one may be drawn on the same
line. This mode is useful for reducing the amount of space used by a track when you want to view a
large number of individual features and get an overall view of an annotation. It is particularly
good for displaying tracks in which a large number of features align to a particular section of a
chromosome, e.g. EST tracks.
-
Pack: the track is displayed with each annotation feature shown separately and
labeled, but not necessarily displayed on a separate line. This mode is useful for reducing the
amount of space used by a track when you want to view the large number of individual features
allowed by squish mode, but need the labeling and display size provided by full mode. When the
number of lines within the requested track location exceeds 250, the track automatically defaults
to squish display mode. In this situation, you can restore the track display to pack mode by
narrowing the chromosomal range displayed or by using a track filter to reduce the number of items
displayed. To toggle between pack and full display modes, click on the track's center label.
The track display controls are grouped into categories that reflect the type of data in the track,
e.g., Gene Prediction Tracks, mRNA and EST tracks, etc. To change the display mode for a track, find
the track's controller in the Track Controls section at the bottom of the Genome Browser page,
select the desired mode from the control's display menu, and then click the refresh button.
Alternatively, you can change the display mode by using the Genome Browser's
right-click navigation feature, or can toggle between dense and full
modes for a displayed track (or pack mode when available) by clicking on the optional center label
for the track.
Changing the display mode for a group of tracks
Track display modes may be set individually or as a group on the Genome Browser Track Configuration
page. To access the configuration page, click the configure button on the annotation tracks
page or the configure tracks and display button on the Gateway page. Exercise caution when
using the show all buttons on track groups or assemblies that contain a large number
tracks; this may seriously impact the display performance of the Genome Browser or cause your
Internet browser to time out.
Hiding the track display controls
The entire set of track display controls at the bottom of the annotation tracks page may be hidden
from view by checking the Show track controls under main graphic option in the Configure
Image section of the Track Configuration page.
Changing the display of a track by using filters and configuration options
Some tracks have additional filter and configuration capabilities, e.g., EST tracks, mRNA tracks,
NC160, etc. These options let the user modify the color or restrict the data displayed within an
annotation track. Filters are useful for focusing attention on items relevant to the current task in
tracks that contain large amounts of data. For example, to highlight ESTs expressed in the liver,
set the EST track filter to display items in a different color when the associated tissue keyword is
"liver" Configuration options let the user adjust the display to best show the data of
interest. For example, the min vertical viewing range value on wiggle tracks can be used to
establish a data threshold. By setting the min value to "50", only data values greater
than 50 percent will display.
To access filter and configuration options for a specific annotation track, open the track's
description page by clicking the label for the track's control menu under the Track Controls
section, the mini-button to the left of the displayed track, or the "Configure..." option
from the Genome Browser's right-click popup menu. The filter and
configration section is located at the top of the description page. In most instances, more
information about the configuration options is available within the description text or through a
special help link located in the configuration section.
Filter and configuration settings are persistent from session to session on the same web browser.
To return the Genome Browser display to the default set of tracks (but retain custom tracks and
other configured Genome Browser settings), click the default tracks button on the Genome
Browser tracks page. To remove all user configuration settings and custom tracks, and completely
restore the defaults, click the "Click here to reset" link on the Genome Browser Gateway
page.
Zooming and scrolling the tracks display
At times you may want to adjust the amount of flanking region displayed in the annotation tracks
window or adjust the scale of the display. At a scale of 1 pixel per base pair, the window
accurately displays the width of exons and introns, and indicates the direction of transcription
(using arrowheads) for multi-exon features. At a grosser scale, certain features - such as thin
exons - may disappear. Also, some exons may falsely appear to fall within RepeatMasker features at
some scales.
Click the zoom in and zoom out buttons at the top of the Genome Browser page to
zoom in or out on the center of the annotation tracks window by 1.5, 3 or 10-fold. Alternatively,
you can zoom in 3-fold on the display by clicking anywhere on the Base Position track. In this case,
the zoom is centered on the coordinate of the mouse click. To view the base composition of the
sequence underlying the current annotation track display, click the base button.
Quickly zoom to a specific region of interest by using the browser's "drag-and-select"
feature. To define the region you wish to zoom to, click and hold the mouse button on one edge of
the desired zoom area in the Base Position track, drag the mouse right or left to highlight the
selection area, then release the mouse button. A "drag-and-select" popup will appear.
Click on the "Zoom In" button to zoom in on the selected region. To disable the
drag-and-select popup, check the "Don't show this dialog again and always zoom" checkbox.
To drag-and-select (zoom) on a part of the image other than the Base Position track, depress the
shift key before clicking and dragging the mouse. Note that the Enable advanced javascript
features option on the Track Configuration page must be toggled on to use this feature.
To scroll (pan) the view of the entire tracks image horizontally, click on the image and drag the
cursor to the left or right, then release the mouse button, to shift the displayed region in the
corresponding direction. The view may be scrolled by up to one image width. To scroll the annotation
tracks horizontally by set increments of 10%, 50%, or 95% of the displayed size (as given in base
pairs), click the corresponding move arrow. It is also possible to scroll the left or right
side of the tracks by a specified number of vertical gridlines while keeping the position of the
opposite side fixed. To do this, click the appropriate move start or move end
arrow, located under the annotation tracks window. For example, to keep the left-hand display
coordinate fixed but increase the right-hand coordinate, you would click the right-hand move
end arrow. To increase or decrease the gridline scroll interval, edit the value in the
move start or move end text box.
Highlighting a region
The browser's "drag-and-select" pop-up menu provides options to add single or
multiple vertical highlights to selected regions, as described below:
Main features in drag-and-select menu:
-
Use shift+drag or click-drag to enable the "drag-and-select"
dialog box menu.
-
In the menu, a checkbox controls behavior for drag-and-select; you
can hide the menu and always zoom with shift+select. If selected, re-enable
via 'View - Configure Browser' (keyboard shortcut: c then f).
-
A "color picker" option allows for easy color selection of each highlight;
you can also create multiple highlights (each with various colors if
desired).
-
Hold Shift+drag to show the menu (or click+drag).
-
Hold Alt+drag to add a highlight (without displaying the menu).
-
Hold Ctrl+drag (Windows) or Cmd+drag (Mac) to zoom (without displaying the
menu).
-
To cancel, press Esc anytime or drag mouse outside image.
-
Highlight the current position with the keyboard shortcut "h then
m."
-
Clear all highlights with View - Clear Highlights (or keyboard shortcut
h then c), or simply right-click on a highlight to remove all highlights.
In the genome browser, there are also options for right-clicking:
-
Remove highlighting
-
Zoom in to a highlighted region
-
Highlight a gene - right-click on the gene (e.g., SOD1) and select
"Highlight SOD1"
Changing the displayed track position
To display a completely different position in the genome, enter the new query in the
position/search text box, then click the jump button. For more information on
valid entries for this text box, refer to the Getting started section.
If a chromosome image (ideogram) is available above the track display, click anywhere on the
chromosome to move to that position (the current window size will be maintained). Select a region
of any size by clicking and dragging in the image. Finally, hold the "control" key while
clicking on a chromosome band to select the entire band.
Changing the order of the displayed tracks
To vertically reposition a track in the annotation track window, click-and-hold the mouse button on
the side label, then drag the highlighted track up or down within the image. Release the mouse
button when the track is in the desired position. To move an entire group of associated tracks (such
as all the displayed subtracks in a composite track), click-and-hold the gray mini-button to the
left of the tracks, then drag.
Viewing multiple regions
To remove intronic or intergenic regions from the display or to view only custom specified regions,
click the multi-region button under the track image. For human assemblies hg17 and later,
you may also replace a section of the reference genome with an alternate haplotype chromosome in
order to view annotations upstream and downstream of the sequence. For more information about the
multi-region feature see the multi-region help page.
Changing the width of the annotation track window
The first time the annotation track window is displayed, or after the Genome Browser has been reset,
the size of the track window is set by default to the width that best fits your Internet browser
window. If you horizontally resize the browser window, you can automatically adjust the annotation
track image size to the new width by clicking the resize button under the track image. To
manually override the default width, enter a new value in the image width text box on the
Track Configuration page, then click the submit button. The maximum supported width is 5000
pixels.
Changing the width of the label area to the left of the image
The item labels (or track label, when viewed in dense mode) are displayed to the left of the
annotation image. The width of this area is set to 17 characters by default. To change the width,
edit the value in the label area width text box on the Track Configuration page, then click
Submit.
Changing the text size in the annotation track image
The annotation track image may be adjusted to display text in a range of fonts from "tiny"
to "huge". To change the size of the text, select an option from the text size
pull-down menu on the Track Configuration page, then click Submit. The text size is set to
"small" by default.
Hiding the annotation track labels
The track and element labels displayed above and to the left of the tracks in the annotation tracks
image may be hidden from view by unchecking the Display track descriptions above each track
and Display labels to the left of items in tracks boxes, respectively, on the Track
Configuration page.
Hiding the display grid on the annotation tracks image
The light blue vertical guidelines on the annotation tracks image may be removed by unchecking the
Show light blue vertical guidelines box on the Track Configuration page.
Hiding the chromosome ideogram
The chromosome ideogram, located just above the annotation tracks image, provides a graphical
overview of the features on the selected chromosome, including its bands, the position of the
centromere, and an indication of the region currently displayed in the annotation tracks image. To
hide the ideogram, uncheck the Display chromosome ideogram above main graphic box on the
Tracks Configuration page.
Enabling item and exon navigation
When the Next/previous item navigation configuration option is toggled on, on the Track
Configuration page, gray double-headed arrows display in the Genome Browser tracks image on both
sides of the track labels of gene, mRNA and EST tracks (or any standard tracks based on BED, PSL or
genePred format). Clicking on the gray arrows shifts the image window toward that end of the
chromosome so that the next item in the track is displayed. Similarly, the Next/previous exon
navigation configuration option displays white double-headed arrows on the end of any item that
extends off the edge of the current image. Clicking on one of the white arrows shifts the image
window to the next exon in the indicated direction, unless the image window interrupts an exon, in
which case the window shifts to the edge of the current exon. If the image window happens to be
within a 5' or 3' UTR, then clicking the arrows shifts the image window towards the start or end of
the next coding region, not the end of the exon.
Enabling the right-click navigation feature
Several of the common display and navigation operations offered on the Genome Browser tracks page
may be quickly accessed by right-clicking on a feature on the tracks image and selecting an option
from the displayed popup menu. Depending on context, the right-click feature allows the user
to:
-
change the track display mode
-
zoom in or out to the exact position coordinates of the feature
-
open the "Get DNA" window at the feature's coordinates
-
display details about the feature
-
open a popup window to configure the track's display
-
display the entire tracks image in a separate window for inclusion in spreadsheets or other
documents. (Note that the Genome Browser "PDF/PS" described below can also be used to
generate a high-quality annotation tracks image suitable for printing.)
To use the right-click feature, make sure the Enable advanced javascript features option on
the Track Configuration page is checked, and configure your internet browser to allow the display of
popup windows from genome.ucsc.edu. When enabled, the right-click navigation feature replaces the
default contextual popup menu typically displayed by the Internet browser when a user right-clicks
on the tracks image. A few combinations of the Mozilla Firefox browser on Mac OS do not support the
right-click menu functionality using secondary click; in these instances, ctrl+left-click must be
used to display the menu.
Printing a copy of the annotation track window
The Genome Browser provides a mechanism for saving a copy of the currently displayed annotation
tracks image to a file that can be printed or edited. Images saved in PostScript format can be
printed at high resolution and edited by drawing programs such as Adobe Illustrator. This is useful
for generating figures intended for publication. Images can also be saved in PDF format for viewing
by Adobe Acrobat Reader.
To print or save the image to a file:
-
In the blue navigation bar at the top of the screen, from the "View" menu, click the
"PDF/PS" link.
-
Click one of the PDF or EPS links.
NOTE: If you have configured your browser image to use one of the larger font sizes, the text in the
resulting screen shot may not display correctly. If you encounter this problem, reduce the Genome
Browser font size using the Configuration utility, then repeat the
save/print process.
Using BLAT alignments
BLAT (BLAST-Like Alignment Tool) is a very fast sequence alignment tool similar to BLAST. For more
information on BLAT's internal scoring schemes and its overall n-mer alignment seed strategy, refer
to W. James Kent (2002) BLAT - The BLAST-Like Alignment Tool, Genome Res 12:4 656-664.
On DNA queries, BLAT is designed to quickly find sequences with 95% or greater similarity of length
25 bases or more. It may miss genomic alignments that are more divergent or shorter than these
minimums, although it will find perfect sequence matches of 32 bases and sometimes as few as 22
bases. The tool is capable of aligning sequences that contain large introns. On protein queries,
BLAT rapidly locates genomic sequences with 80% or greater similarity of length 20 amino acids or
more. In general, gene family members that arose within the last 350 million years can generally be
detected. More divergent sequences can be aligned to the human genome by using NCBI's BLAST and
psi-BLAST, then using BLAT to align the resulting match onto the UCSC genome assembly. In practice
DNA BLAT works well on primates, and protein BLAT works well on land vertebrates.
Some common uses of BLAT include:
-
finding the genomic coordinates of mRNA or protein within a given assembly
-
determining the exon structure of a gene
-
displaying a coding region within a full-length gene
-
isolating an EST of special interest as its own track
-
searching for gene family members
-
finding human homologs of a query from another species
Making a BLAT query
To locate a nucleotide or protein within a genome using BLAT:
-
Open the BLAT Search Genome page
by clicking on the "Tools" pulldown in the top blue menu bar of the Genome Browser.
-
Select the genome, assembly, query type, output sort order, and output type. To order the search
results based on the closeness of the sequence match, choose one of the score options in the
Sort output menu. The score is determined by the number of matches vs. mismatches in the
final alignment of the query to the genome.
-
If the sequence to be uploaded is in an unformatted plain text file, enter the file name in the
Upload sequence text box, then click the submit file button. Otherwise, paste
the sequence or fasta-formatted list into the large edit box, and then click the submit
button. Input sequence can be obtained from the Genome Browser as well as from a custom annotation
track.
Header lines may be included in the input text if they are preceded by > and contain unique names.
Multiple sequences may be submitted at the same time if they are of the same type and are preceded
by unique header lines. Numbers, spaces, and extraneous characters are ignored:
>sequence_1
ATGCAGAGCAAGGTGCTGCTGGCCGTCGCCCTGTGGCTCTGCGTGGAGAC
CCGGGCCGCCTCTGTGGGTTTGCCTAGTGTTTCTCTTGATCTGCCCAGGC
>sequence_2
ATGTTGTTTACCGTAAGCTGTAGTAAAATGAGCTCGATTGTTGACAGAGA
TGACAGTAGTATTTTTGATGGGTTGGTGGAAGAAGATGACAAGGACAAAG
>sequence_3
ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGC
CGCGGCGTCCCCGCTCCTGCTGCTGCTGCTGCTGCTCGCCTGGTGCGCGG
BLAT limitations
DNA input sequences are limited to a maximum length of 25,000 bases. Protein or translated input
sequences must not exceed 10,000 letters. As many as 25 multiple sequences may be submitted at the
same time. The maximum combined length of DNA input for multiple sequence submissions is 50,000
bases (with a 25,000 base limit per individual sequence). For protein or translated input, the
maximum combined input length is 25,000 letters (with a 5000 letter limit per individual
sequence).
NOTE: Program-driven BLAT use is limited to a maximum of one hit every 15 seconds and no more than
5000 hits per day.
BLAT query search results
If a query returns successfully, BLAT will display a flat database file that summarizes the
alignments found. A BLAT query often generates multiple hits. This can happen when the genome
contains multiple copies of a sequence, paralogs, pseudogenes, statistical coincidences,
artifactual assembly duplications, or when the query itself contains repeats or common
retrotransposons. When too many hits occur, try resubmitting the query sequence after filtering in
slow mode with RepeatMasker.
Items in the search results list are ordered by the criteria specified in the Sort output
menu. Each line item provides links to view the details of the sequence alignment or to open the
corresponding view in the Genome Browser. The details link gives the letter-by-letter
alignment of the sequence to the genome. It is recommended that you first examine the details of the
alignment for match quality before viewing the sequence in the Genome Browser.
When several nearby BLAT matches occur on a single chromosome, a simple trick can be used to quickly
adjust the Genome Browser track window to display all of them: open the Genome Browser with the
match that has the lowest chromosome start coordinate, paste in the highest chromosome end
coordinate from the list of matches, then click the jump button.
Creating a custom annotation track from BLAT output
To make a custom track directly from BLAT, select the
PSL format output option. The resulting PSL track can
be uploaded into the Genome Browser by pasting the data into the data text box on the Genome Browser
Add Custom Tracks page, accessed via the "add custom
tracks" button on the Browser gateway and annotation tracks pages. See the
Creating custom annotation tracks section for more information.
Using BLAT for large batch jobs or commercial use
For large batch jobs or internal parameter changes, it is best to install command line BLAT on your
own Linux server. Sources and executables are free for academic, personal, and non-profit purposes.
BLAT source may be downloaded from http://www.soe.ucsc.edu/~kent (look for the blatSrc*.zip file with the
most recent date). For BLAT executables, go to http://genome-test.soe.ucsc.edu/~kent/exe/; binaries are sorted by platform.
Non-exclusive commercial licenses are available from the Kent Informatics website.
BLAT documentation
For more information on the BLAT suite of programs, see the BLAT Program
Specifications and the Blat section of the Genome
Browser FAQ.
Annotation track descriptions
Detailed information about an individual annotation track, including display characteristics,
configuration information, and associated database tables, may be obtained from the track
description page accessed by clicking the mini-button to the left of the displayed track in the
Genome Browser, or by selecting the "Open details..." or "Show details..."
option from the Genome Browser's right-click menu. Click the
"View table schema" link on the track description page to display additional information
about the primary database table underlying the track. Table schema information may also be accessed
via the "describe table schema" button in the Table Browser.
For more information on configuring and using the tracks displayed in the Genome Browser track
window, see the section Interpreting and Fine-tuning the Genome Browser
display.
Tips for viewing annotation track data
-
To display a description page with more information about the track, click on the mini-button to
the left of a track.
-
To display a details page with additional information about a specific line item within a track in
full display mode, click on the item or its label.
-
A track does not appear in the browser if its display mode is set to hide. To restrict
the browser's display to only those tracks in which you're interested, set the display mode of the
unwanted tracks to hide.
-
A track set to full display mode will default to a more tightly packed display mode if
the total number of lines in the track exceeds 250.
-
To quickly toggle between full and dense or pack display modes, click
on the track's center label.
-
Only the most recent assemblies are fully active. The data for older assemblies may be available
on our Downloads
page.
-
Not all tracks appear in all assemblies. Only a basic set of tracks appears initially in a new
assembly.
-
Track data can be viewed as text tables using the Table Browser.
-
Credit goes to many individuals and institutions for
generously contributing the tracks. For specific information about the contributors of a given
track, look at the Credits section on a track's description page.
Getting started on the Table Browser
The Table Browser provides text-based access
to the genome assemblies and annotation data stored in the Genome Browser database. As a flexible
alternative to the graphical-based Genome Browser, this tool offers an enhanced level of query
support that includes restrictions based on field values, free-form SQL queries, and combined
queries on multiple tables. Output can be filtered to restrict the fields and lines returned, and
may be organized into one of several formats, including a simple tab-delimited file that can be
loaded into a spreadsheet or database as well as advanced formats that may be uploaded into the
Genome Browser as custom annotation tracks. The Table Browser provides a convenient alternative to
downloading and manipulating the entire genome and its massive data tracks. (See the
Downloading Genome Data section.)
For information on using the Table Browser features, refer to the
Table Browser User Guide.
Getting started using Sessions
The Sessions tool allows users to configure
their browsers with specific track combinations, including custom tracks, and save the configuration
options. Multiple sessions may be saved for future reference, for comparison of scenarios or for
sharing with colleagues. Saved sessions persist for four months after the last access, unless
deleted. User-generated tracks can be saved
within sessions.
This tool may be accessed by clicking the "My Data" pulldown in the top blue navigation
bar in any assembly and then selecting Sessions. To ensure privacy and security,
you must create an account and/or
log in to use the Session tool. Individual
sessions may be designated by the user as either "shared" or "non-shared" to
protect the privacy of confidential data. To avoid having a new shared session from someone else
override existing Genome Browser settings, users are encouraged to open a new web-browser instance
or to save existing settings in a session before loading a new shared session.
For more detailed information on using the Session tool, see the
Sessions User Guide.
Getting started on Genome Graphs
The Genome Graphs tool can be used to display
genome-wide data sets such as the results of genome-wide SNP association studies, linkage studies,
and homozygosity mapping. This tool is not pre-loaded with any sample data; instead, you can upload
your own data for display by the tool.
Once you have uploaded your data, you can view it in a variety of ways. You can view multiple sets
of genome-wide data simultaneously either as superimposed graphs or side-by-side graphs. Once you
see an area of interest in the Genome Graphs view, you can click on it to go directly to the Genome
Browser at that position. You can also set a significance threshold for your data and view only
regions or gene sets that meet that threshold.
For information on using the Genome Graphs features, refer to the
Genome Graphs User Guide.
Using the VisiGene Image Browser
VisiGene is a browser for viewing in situ images. It
enables the user to examine cell-by-cell as well as tissue-by-tissue expression patterns. The
browser serves as a virtual microscope, allowing users to retrieve images that meet specific search
criteria, then interactively zoom and scroll across the collection.
To start the VisiGene browser, click the VisiGene link in the left-hand sidebar menu on the
Genome Browser home page.
Images Available
The following image collections are currently available for browsing:
Searching the Image Database
The image database may be searched by gene symbols, authors, years of publication, body parts,
GenBank or UniProtKB accessions, organisms,
Theiler stages (mice), and Nieuwkoop/Faber stages (frogs). The search returns only those images that match
all the specified criteria. For a list of sample search strings, see the VisiGene Gateway page.
The wildcard characters * and ? are supported for gene name searches. For example, to view the
images of all genes in the Hox A cluster, search for hoxa*. When searching on author names
that include initials, use the format Smith AJ.
Image Navigation
Following a successful search, VisiGene displays a list of thumbnails of images matching the search
criteria in the lefthand pane of the browser. By default, the image corresponding to the first
thumbnail in the list is displayed in the main image pane. If more than 25 images meet the search
criteria, links at the bottom of the thumbnail pane allow the user to toggle among pages of search
results. To display a different image in the main browser pane, click the thumbnail of the image you
wish to view.
By default, an image is displayed at a resolution that provides optimal viewing of the overall
image. This size varies among images. The image may be zoomed in or out, sized to match the
resolution of the original image or best fit the image display window, and moved or scrolled in any
direction to focus on areas of interest. The original full-sized image may also be downloaded.
Zooming in: To enlarge the image by 2X, click the Zoom in button above
the image or click on the image using the left mouse button. Alternatively, the + key may be used
to zoom in when the main image pane is the active window.
Zooming out: To reduce the image by 2X, click the Zoom out button above
the image or click on the image using the right mouse button. Alternatively, the - key may be used
to zoom out when the main image pane is the active window.
Sizing to full resolution: Click the Zoom full button above the image to
resize the image such that each pixel on the screen corresponds to a pixel in the digitized
image.
Sizing to best fit: Click the Zoom fit button above the image to zoom the
image to the size that best fits the main image pane.
Moving the image: To move the image viewing area in any direction, click and drag
the image using the mouse. Alternatively, the following keyboard shortcuts may be used after
clicking on the image:
-
Scroll left in the image: Left-arrow key or Home key
-
Scroll right in the image: Right-arrow key or End key
-
Scroll up in the image: Up-arrow key or PgUp key
-
Scroll down in the image: Down-arrow key or PgDn key
Downloading the original full-sized image: Most images may be viewed in their
original full-sized format by clicking the "download" link at the bottom of the image
caption. NOTE: due to the large size of some images, this action may take a long time and could
potentially exceed the capabilities of some Internet browsers.
If you have an image set you would like to contribute for display in the VisiGene Browser, contact
Jim Kent.
DNA text formatting
The Genome Browser provides a feature to configure the retrieval, formatting, and coloring of the
text used to depict the DNA sequence underlying the features in the displayed annotation tracks
window. Retrieval options allow the user to add a padding of extra bases to the upstream or
downstream end of the sequence. Formatting options range from simply displaying exons in upper case
to elaborately marking up a sequence according to multiple track data. The DNA sequence covered by
various tracks can be highlighted by case, underlining, bold or italic fonts, and color.
The DNA display configuration feature can be useful to highlight features within a genomic sequence,
point out overlaps between two types of features (for example, known genes vs. gene predictions), or
mask out unwanted features.
Using the DNA text formatting feature
To access the feature, click on the "View" pulldown on the top blue menu bar on the Genome
Browser page and select "DNA", or select the "Get DNA..." option from the Genome
Browser's right-click menu depending on context. "The Get DNA in
Window" page that appears contains sections for configuring the retrieval and output
format.
To display extra bases upstream of the 5' end of your sequence or downstream of the 3' end of the
sequence, enter the number of bases in the corresponding text box. This option is useful in looking
for regulatory regions.
The Sequence Formatting section lists several options for adjusting the case of all or part of the
DNA sequence. To choose one of these formats, click the corresponding option button, then click the
get DNA button. To access a table of extended formatting options, click the Extended
case/color options button.
The Extended DNA Case/Color page presents a table with many more format options. The page provides
instructions for using the formatting table, as well as examples of its use. The list of tracks in
the Track Name column is automatically generated from the list of tracks available on the current
genome.
Tips for Use
A few caveats mentioned on the Extended DNA Case/Color page bear repeating. Keep the formatting
simple at first: it is easy to make a display that is pretty to look at but is also completely
cryptic. Also, be careful when requesting complex formatting for a large chromosomal region: when
all the HTML tags have been added to the output page, the file size may exceed the size limits that
your Internet browser, clipboard, and other software can safely display. The maximum size of genome
that can be formatted by the tool is approximately 10 Mbp.
Converting data between assemblies
Coordinates of features frequently change from one assembly to the next as gaps are closed, strand
orientations are corrected, and duplications are reduced. Occasionally, a chunk of sequence may be
moved to an entirely different chromosome as the map is refined. There are three different methods
available for migrating data from one assembly to another: BLAT alignment, coordinate conversion,
and coordinate lifting. The BLAT alignment tool is described in the section
Using BLAT alignments.
Coordinate conversion
The Genome Browser Convert utility is useful for locating the position of a feature of interest in
a different release of the same genome or (in some cases) in a genome assembly of another species.
During the conversion process, portions of the genome in the coordinate range of the original
assembly are aligned to the new assembly while preserving their order and orientation. In general,
it is easier to achieve successful conversions with shorter sequences.
When coordinate conversion is available for an assembly, click on the "View" pulldown on
the top blue menu bar on the Genome Browser page and select the "In Other Genomes
(Convert)" link. You will be presented with a list of the genome/assembly conversion options
available for the current assembly. Select the genome and assembly to which you'd like to convert
the coordinates, then click the Submit button. If the conversion is successful, the browser will
return a list of regions in the new assembly, along with the percent of bases and span covered by
that region. Click on a region to display it in the browser. If the conversion is unsuccessful, the
utility returns a failure message.
Lifting coordinates
The liftOver tool is useful if you wish to convert a large number of coordinate ranges between
assemblies. This tool is available in both web-based and command line forms, and supports
forward/reverse conversions as well as conversions between species.
Web-based coordinate lifting
To access the graphical version of the liftOver tool, click on "Tools" pulldown in the
top blue menu bar of the Genome Browser, then select
LiftOver from the menu.
To convert one or more coordinate ranges using the default conversion settings:
-
Select the genome and assembly from which the ranges were taken ("Original"), as well as
the genome and assembly to which the coordinates should be converted ("New").
-
Select the Data Format option: Browser Extensible Data format
(BED) or position (coordinates of the form
chrN:start-end).
-
Enter coordinate ranges in the selected data format into the large text box, one per line.
-
Click Submit.
Alternatively, you may load the coordinate ranges from an existing data file by entering the file
name in the upload box at the bottom of the screen, then clicking the Submit File button.
The default parameter settings are recommended for general purpose use of the liftOver tool.
However, you may want to customize settings if you have several very large regions to convert.
Command-line coordinate lifting
The command-line version of liftOver offers the increased flexibility and performance gained by
running the tool on your local server. This utility requires access to a Linux platform. The
executable file may be downloaded here.
Command-line liftOver requires a UCSC-generated over.chain file as input. Pre-generated
files for a given assembly can be accessed from the assembly's "LiftOver files" link on
the Downloads page. If the desired
conversion file is not listed, send a request to the genome mailing
list and we may be able to generate one for you.
Downloading genome data
Most of the underlying tables containing the genomic sequence and annotation data displayed in the
Genome Browser can be downloaded. All of the tables are freely usable for any purpose except as
indicated in the README.txt file in the download directories. This data was contributed by many
researchers, as listed on the Genome Browser Credits
page. Please acknowledge the contributor(s) of the data you use.
Downloading the data
Genome data can be downloaded in different ways:
-
Via rsync: The UCSC Genome Bioinformatics hgdownload site contains download
directories for all genome versions currently accessible in the Genome Browser. The rsync command
rsync -a -P rsync://hgdownload.soe.ucsc.edu/path/file ./
can quickly and efficiently
download large files to your current directory (./). To download an entire directory (note the
trailing slash), you would use an expression such as
rsync -a -P rsync://hgdownload.soe.ucsc.edu/directory/ ./
For more information please
click here.
-
Via ftp: The UCSC Genome Bioinformatics ftp site contains download directories
for all genome versions currently accessible in the Genome Browser. The ftp command
ftp://hgdownload.soe.ucsc.edu/goldenPath/
will take you to a directory that contains
the genome download directories. This download method is not recommended if you plan to download
a large file or multiple files from a single directory compared to rsync (see above). You can,
however, use the mget command to download multiple files: mget filename1
filename2, or mget -a (to download all the files in the directory).
-
Via the Downloads link: Click the
Downloads link on the
left side bar on the UCSC Genome Bioinformatics home page to display a list of all database
directories available for download. If the data you wish to download pre-dates the assembly
versions listed, look for the data on our Downloads page.
Types of data available
There may be several download directories associated with each version of a genome assembly: the
full data set (bigZips), the full data set by chromosome (chromosome), the
annotation database tables (database), and one or more sets of comparative cross-species
alignments.
BigZips contains the entire draft of the genome in chromosome and/or contig form. Depending
on the genome, this directory may contain some or all of the following files:
-
chromAgp.zip: Description of how the assembly was generated, unpacking to one
file per chromosome.
-
chromFa.zip: The assembly sequence chromosomes, in one file per chromosome.
Repeats from RepeatMasker and Tandem Repeats Finder are shown in lower case; non-repeating
sequence is in upper case. The main assembly is contained in the chrN.fa files, where
chrN is the name of the chromosome. The chrN_random.fa files contain clones
that are not yet finished or cannot be placed with certainty at a specific place on the
chromosome. In some cases, including the human HLA region on chromosome 6, the
chrN_random.fa files also contain haplotypes that differ from the main assembly.
-
chromFaMasked.zip: The assembly sequence chromosomes, in one file per chromosome.
Repeats are masked by capital Ns; non-repeating sequence is shown in upper case.
-
chromOut.zip: RepeatMasker .out file for chromosomes, generated by
RepeatMasker at the -s sensitive setting.
-
chromTrf.zip: Tandem Repeats Finder locations, filtered to keep repeats with
period less than or equal to 12, translated into one .bed file per chromosome.
-
contigAgp.zip: Description of how the assembly was generated from fragments at a
contig layout level.
-
contigFa.zip: The assembly sequence contigs, in one file per contig. All contigs
are in forward orientation relative to the chromosome. In some cases, this means that contigs will
be reversed relative to their orientation in the NCBI assembly. Repeats are shown in lower case;
non-repeating sequence is shown in upper case.
-
contigFaMasked.zip: The assembly sequence contigs, in one file per contig.
Repeats are masked by capital Ns; non-repeating sequence is shown in upper case.
-
contigOut.zip: RepeatMasker .out file for contigs, generated by
RepeatMasker at the -s sensitive setting.
-
contigTrf.zip: Tandem Repeats Finder locations, filtered to keep repeats with
period less than or equal to 12, and translated into one .bed file per contig.
-
database.zip: The Genome Browser database as tab-delimited files and associated
MySQL table-creation tiles (eliminated in later assemblies due to size restrictions).
-
est.fa.zip: Sequences of all GenBank ESTs for the selected species.
-
liftAll.zip: The offsets of contigs within chromosomes.
-
mrna.zip: mRNAs in GenBank from the selected species.
-
refmrna.zip: RefSeq mRNAs from the selected species.
-
upstream1000.zip: Sequences 1000 bases upstream of annotated transcription start
of RefSeq genes. This includes only cases where the transcription start is annotated separately
from the coding region start.
-
upstream2000.zip: Same as upstream1000, but with 2000 bases.
-
upstream5000.zip: Same as upstream1000, but with 5000 bases.
-
xenoMrna.zip: All GenBank mRNAs from species other than that of the selected
one.
Chromosomes contains the assembled sequence for the genome in separate files for each
chromosome in a zipped fasta format. The main assembly can be found in the chrN.fa files,
where N is the name of the chromosome. The chrN_random.fa files contain clones
that are not yet finished or cannot be placed with certainty at a specific place on the chromosome.
In some cases, the chrN_random.fa files also contain haplotypes that differ from the main
assembly.
Database contains all of the positional and non-positional tables in the genome annotation
database. Each table is represented by 2 files:
- .sql file: the MySQL commands used to create the table.
-
.txt.gz file: the MySQL database table data in tab-delimited format and
compressed with gzip.
Schema descriptions for all tables in the genome annotation database may be viewed by using the
"describe table schema" button in the Table Browser.
Cross-species alignments directories, such as the vsMm4 and humorMm3Rn3
directories in the hg16 assembly, contain pairwise and multiple species alignments and filtered
alignment files used to produce cross-species annotations. For more information, refer to the
READMEs in these directories and the description of the
Multiple Alignment Format (MAF).
Creating custom annotation tracks
The Genome Browser provides dozens of aligned annotation tracks that have been computed at UCSC or
have been provided by outside collaborators. In addition to these standard tracks, it is also
possible for users to upload their own annotation data for temporary display in the browser. These
custom annotation tracks are viewable only on the machine from which they were uploaded and are
automatically discarded 48 hours after the last time they are accessed, unless they are saved in a
Session. Optionally, users can make custom
annotations viewable by others as well. For a more stable option for custom annotations, we suggest
using track hubs. A third, more technical, option is to operate a mirror. Custom tracks work well for quickly displaying data, while track hubs are
more configurable and permanent.
Custom tracks are a wonderful tool for research scientists using the Genome Browser. Because space
is limited in the Genome Browser track window, many excellent genome-wide tracks cannot be included
in the standard set of tracks packaged with the browser. Other tracks of interest may be excluded
from distribution because the annotation track data is too specific to be of general interest or
can't be shared until journal publication. In the past, many individuals and labs contributed custom
tracks to the Genome Browser website for use by others. To view a list of these custom annotation
tracks, click here.
Track hubs are now the preferred approach for viewing and sharing data on the Browser. Labs,
consortia, and institutions submit their hubs to be listed as a Public Hub. Track hubs require remotely hosted data. They use binary index
files which allow the browser to quickly access only what is relevant for the current region being
viewed in the browser. See the track hub help
page for more information.
Custom annotation tracks are similar to standard tracks, but never become part of the MySQL genome
database. Each track has its own controller and persists even when not displayed in the Genome
Browser window, e.g., if the position changes to a range that no longer includes the track.
Typically, custom annotation tracks are aligned under corresponding genomic sequence, but they can
also be completely unrelated to the data. For example, a track can be displayed under a long
sequence consisting of millions of Ns.
Genome Browser annotation tracks are based on files in line-oriented format. Each line in the file
defines a display characteristic for the track or defines a data item within the track. Annotation
files contain three types of lines: browser lines, track lines, and data lines. Empty lines and
those starting with "#" are ignored.
To construct an annotation file and display it in the Genome Browser, follow these steps:
Step 1. Format the data set
Formulate your data set as a tab-separated file using one of the formats supported by the Genome
Browser. Annotation data can be in standard
GFF format or in a format designed specifically for
the Human Genome Project or UCSC Genome Browser, including
bedGraph,
GTF,
PSL,
BED,
bigBed, WIG,
bigGenePred,
bigMaf,
bigChain,
bigPsl,
barChart,
bigBarChart,
bigWig,
BAM,
CRAM,
VCF,
MAF,
BED detail,
Personal Genome SNP,
broadPeak,
narrowPeak,
and microarray
(BED15). GFF and GTF files must be tab-delimited rather than space-delimited to display
correctly. Chromosome references must be of the form chrN (the parsing of chromosome names
is case-sensitive). You may include more than one data set in your
annotation file; these need not be in the same format.
Step 2. Define the Genome Browser display characteristics
Add one or more optional browser lines to the beginning of your formatted data
file to configure the overall display of the Genome Browser when it initially shows your annotation
data. Browser lines allow you to configure such things as the genome position that the Genome
Browser will initially open to, the width of the display, and the configuration of the other
annotation tracks that are shown (or hidden) in the initial display. NOTE: If the browser position
is not explicitly set in the annotation file, the initial display will default to the position
setting most recently used by the user, which may not be an appropriate position for viewing the
annotation track.
Step 3. Define the annotation track display characteristics
Following the browser lines--and immediately preceding the formatted data--add a
track line to define the display attributes for your annotation data set. Track
lines enable you to define annotation track characteristics such as the name, description, colors,
initial display mode, use score, etc. The track type=<track_type>
attribute is required for some tracks. If you have included more than one data set in your
annotation file, insert a track line at the beginning of each new set of data.
Example #1:
Here is an example of a simple annotation file that contains a list of chromosome coordinates.
browser position chr22:20100000-20100900
track name=coords description="Chromosome coordinates list" visibility=2
chr22 20100000 20100100
chr22 20100011 20100200
chr22 20100215 20100400
chr22 20100350 20100500
chr22 20100700 20100800
chr22 20100700 20100900
Click here to view this track in the Genome Browser.
Example #2:
Here is an example of an annotation file that defines 2 separate annotation tracks in BED format.
The first track displays blue one-base tick marks every 10000 bases on chr 22. The second track
displays red 100-base features alternating with blank space in the same region of chr 22.
browser position chr22:20100000-20140000
track name=spacer description="Blue ticks every 10000 bases" color=0,0,255,
chr22 20100000 20100001
chr22 20110000 20110001
chr22 20120000 20120001
track name=even description="Red ticks every 100 bases, skip 100" color=255,0,0
chr22 20100000 20100100 first
chr22 20100200 20100300 second
chr22 20100400 20100500 third
Click here to view this track in the Genome Browser.
Example #3A:
This example shows an annotation file containing one data set in BED format. The track displays
features with multiple blocks, a thick end and thin end, and hatch marks indicating the direction of
transcription. The track labels display in green (0,128,0), and the gray level of the each feature
reflects the score value of that line. NOTE: The track name line in this example has been split over
2 lines for documentation purposes. If you paste this example into the Genome Browser, you must
remove the line break to display the track successfully. Click here for a copy of this example that can be pasted into the browser without
editing.
browser position chr22:1000-10000
browser hide all
track name="BED track" description="BED format custom track example" visibility=2
color=0,128,0 useScore=1
chr22 1000 5000 itemA 960 + 1100 4700 0 2 1567,1488, 0,2512
chr22 2000 7000 itemB 200 - 2200 6950 0 4 433,100,550,1500 0,500,2000,3500
Click
here to view this track in the Genome Browser.
Example 3B:
This example shows a simple annotation file containing one data set in the bigBed format. This track
displays random sized blocks across chr21 in the human genome. The big data formats, such as the
bigBed format, can be uploaded using a bigDataUrl that is specified in the track line. For more
information on these track line parameters, refer to the Track Lines
section.
You may paste these two lines directly into the "Add Custom Tracks" page to view this example in the
browser:
browser position chr21:33,031,597-33,041,570
track type=bigBed name="bigBed Example One" description="A bigBed file" bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigBedExample.bb
Alternatively, you may also upload just the URL of the bigBed file:
http://genome.ucsc.edu/goldenPath/help/examples/bigBedExample.bb
This will infer the track type as "bigBed" based on the file extension and set the track
name to "bigBedExample".
Step 4. Display your annotation track in the Genome Browser
To view your annotation data in the Genome Browser, open the Genome Browser
home page and click the Genome Browser link in the
top menu bar. On the Gateway page that displays, select the
genome and assembly on which your annotation data is based, then click the "add custom
tracks" button. (Note: if the Gateway displays the "manage custom tracks" button
instead, see Displaying and Managing Custom Tracks for information on how
to display your track.)
On the Add Custom Tracks page, load the annotation track data or URL for your custom track into the
upper text box and the track documentation (optional) into the lower text box, then click the
Submit button. Tracks may be loaded by entering text, a URL, or a pathname on your local computer.
The track type=<track_type> attribute is required for some tracks.
For more information on these methods, as well as information on creating and adding track
documentation, see Loading a Custom Track into the Genome Browser.
If you encounter difficulties displaying your annotation, read the section
Troubleshooting Annotation Display Problems.
Step 5. (Optional) Add details pages for individual track features
After you've constructed your track and have successfully displayed it in the Genome Browser, you
may wish to customize the details pages for individual track features. The Genome Browser
automatically creates a default details page for each feature in the track containing the feature's
name, position information, and a link to the corresponding DNA sequence. To view the details page
for a feature in your custom annotation track (in full, pack, or squish display mode), click on the
item's label in the annotation track window.
You can add a link from a details page to an external web page containing additional information
about the feature by using the track line url attribute. In the annotation file, set the
url attribute in the track line to point to a publicly available page on a web server. The
url attribute substitutes each occurrence of '$$' in the URL string with the name defined
by the name attribute. You can take advantage of this feature to provide individualized
information for each feature in your track by creating HTML anchors that correspond to the feature
names in your web page.
Example 4:
Here is an example of a file in which the url attribute has been set to point to the file
http://genome.ucsc.edu/goldenPath/help/clones.html. The
'#$$' appended to the end of the file name in the example points to the HTML NAME tag within the
file that matches the name of the feature (cloneA, cloneB, etc.). NOTE: The track line in this
example has been split over 2 lines for documentation purposes. If you paste this example into the
browser, you must remove the line break to display the track successfully. Click
here for a copy of this example that can be
pasted into the browser without editing.
browser position chr22:10000000-10020000
browser hide all
track name=clones description="Clones" visibility=2
color=0,128,0 useScore=1
url="http://genome.ucsc.edu/goldenPath/help/clones.html#$$"
chr22 10000000 10004000 cloneA 960
chr22 10002000 10006000 cloneB 200
chr22 10005000 10009000 cloneC 700
chr22 10006000 10010000 cloneD 600
chr22 10011000 10015000 cloneE 300
chr22 10012000 10017000 cloneF 100
Click
here to display this track in the Genome Browser.
Step 6. (Optional) Share your annotation track with others
The previous steps showed you how to upload annotation data for your own use on your own machine.
However, many users would like to share their annotation data with members of their research group
on different machines or with colleagues at other sites. To learn how to make your Genome Browser
annotation track viewable by others, read the section Sharing Your Annotation Track
with Others.
Loading a custom track into the Genome Browser
Using the Genome Browser's custom track upload and management utility, annotation tracks may be
added for display in the Genome Browser, deleted from the Genome Browser, or updated with new data
and/or display options. You may also use this interface to upload and manage custom track sets for
multiple genome assemblies.
To load a custom track into the Genome Browser:
Step 1. Open the Add Custom Tracks page
Select the top blue bar "My Data" menu and click Custom
Tracks. Or, when browsing tracks, click the "add custom tracks" button below the
Genome Browser. (Note: if one or more tracks have already
been uploaded during the current Browser session, additional tracks may be loaded on the Manage
Custom Tracks page. In this case, the button on the Browser page will be labeled "manage
custom tracks" and will automatically direct you to the track management page. See
Displaying and Managing Custom Tracks for more information.)
Step 2. Load the custom track data
The Add Custom Tracks page contains separate sections for uploading custom track data and optional
custom track descriptive documentation. Load the annotation data into the upper section by one of
the following methods:
-
Enter one or more URLs for custom tracks (one per line) in the data text box. The Genome Browser
supports both the HTTP and FTP (passive-only) protocols.
-
Data provided by a URL may need to be proceeded by a separate line defining
type=<track_type> required for some tracks, for example such as
"track type=broadPeak".
-
Click the "Browse" button directly above the data text box, then choose a custom track
file from your local computer, or type the pathname of the file into the "upload" text
box adjacent to the "Browse" button. The custom track data may be compressed by any of
the following programs: gzip (.gz), compress (.Z), or bzip2 (.bz2).
Files containing compressed data must include the appropriate suffix in their names.
-
Paste or type the custom track data directly into the data box. Because the text in this box will
not be saved to a file, this method is not recommended unless you have a copy of the data
elsewhere.
Multiple custom tracks may be uploaded at one time on the Add Custom Tracks page through one of the
following methods:
-
Put all the tracks into the same file (rather than separate files), then load the file via the
Browse button.
-
Place your track files in a web-accessible location on your server, then load them into the Genome
Browser by pasting their URLs into the data box.
NOTE: Please limit the number of custom tracks that you upload and maintain to less
than 1000 tracks. If you have more than this suggested limit of 1000 tracks, please consider
setting up a track hub instead.
Step 3. (Optional) Load the custom track description page
If desired, you can provide optional descriptive text (in plain or HTML format) to accompany your
custom track. This text will be displayed when a user clicks the track's description button on the
Genome Browser annotation tracks page. Descriptive text may be loaded by one of the following
methods:
-
Click the "Browse" button directly above the documentation text box, then choose a text
file from your local computer, or type the pathname of the file into the "upload" text
box adjacent to the "Browse" button.
-
Paste or type the custom track data directly into the data box. Note that the text in this box
will not be saved to a file; therefore, this method is not recommended except for temporary
documentation purposes.
-
If your descriptive text is located on a website, you can reference it from your custom track file
by defining the track line attribute "htmlUrl":
htmlUrl=<external_url>. In this case, there is no need to insert
anything into the documentation text box.
To format your description page in a style that is consistent with standard Genome Browser tracks,
click the template link below the documentation text box for an HTML template that may be copied and pasted into a file for editing.
If you load multiple custom tracks simultaneously using one of the methods described in Step 2, a
track description can be associated only with the last custom track loaded, unless you upload the
descriptive text using the track line "htmlUrl" attribute described above.
Step 4. Upload the track
Click the Submit button to load your custom track data and documentation into the Genome
Browser. If the track uploads successfully, you will be directed to the custom track management page
where you can display your track, update an uploaded track, add more tracks, or delete uploaded
tracks. If the Genome Browser encounters a problem while loading your track, it will display an
error. See the section Troubleshooting Annotation Display Problems for help
in diagnosing custom track problems.
NOTE: Please limit the number of custom tracks that you upload and maintain to less
than 1000 tracks. If you have more than this suggested limit of 1000 tracks, please consider
setting up a track hub instead.
Displaying and managing custom tracks
After a custom track has been successfully loaded into the Genome Browser, you can display it -- as
well as manage your entire custom track set -- via the options on the Manage Custom Tracks page.
This page automatically displays when a track has been uploaded into the Genome Browser (see
Loading a Custom Track into the Genome Browser). Alternatively, you can
access the track management page by clicking the "manage custom tracks" button on the
Gateway or Genome Browser annotation tracks pages. (Note that the track management page is available
only if at least one track has been loaded during the current browser session; otherwise, this
button is labeled "add custom tracks" and opens the Add Custom Track page.)
The table on the Manage Custom Tracks page shows the current set of uploaded custom tracks for the
genome and assembly specified at the top of the page. If tracks have been loaded for more than one
genome assembly, pulldown lists are displayed; to view the uploaded tracks for a different assembly,
select the desired genome and assembly option from the lists.
The following track information is displayed in the Manage Custom Tracks table:
-
Name: a hyperlink to the Update Custom Track page where you can update your
track configuration and data.
-
Description: the value of the "description" attribute from the track
line, if present. If no description is included in the input file, this field contains the track
name.
-
Type: the track type, determined by the Browser based on the format of the
data.
-
Doc: displays "Y" (Yes) if a description page has been uploaded for the
track; otherwise the field is blank.
-
Items: the number of data items in the custom track file. An item count is not
displayed for tracks lacking individual items (e.g. wiggle format data).
-
Pos: the default chromosomal position defined by the track file in either the
browser line "position" attribute or the first data line. Click this link to open the
Genome Browser or Table Browser at the specified position (Note: only the chromosome name is shown
in this column). The Pos column remains blank if the track lacks individual items (e.g. wiggle
format data) and the browser line "position" attribute hasn't been set.
Displaying a custom track in the Genome Browser
Click the "go to genome browser" button to display the entire custom track set for the
specified genome assembly in the Genome Browser. By default, the browser will open to the position
specified in the browser line "position" attribute or first data line of the first custom
track in the table, or the last-accessed Genome Browser position if the track is in wiggle data
format. To open the display at the default position for another track in the list, click the track's
position link in the Pos column.
Viewing a custom track in the Table Browser
Click the "go to table browser" button to access the data for the custom track set in the
Table Browser. The custom tracks will be listed in the "Custom Tracks" group pulldown
list.
Loading additional custom tracks
To load a new custom track into the currently displayed track set, click the "add custom
tracks" button. To change the genome assembly to which the track should be added, select the
appropriate options from the pulldown lists at the top of the page. For instructions on adding a
custom track on the Add Custom Tracks page, see Loading a Custom Track into the
Genome Browser.
Removing one or more custom tracks
To remove custom tracks from the uploaded track set, click the checkboxes in the "delete"
column for all tracks you wish to remove, then click the "delete" button. A custom track
may also be removed by clicking the "Remove custom track" button on the track's
description page. Note: removing the track from the Genome Browser does not delete the track file
from your server or local disk.
Updating a custom track
To update the stored information for a loaded custom track, click the track's link in the
"Name" column in the Manage Custom Tracks table. A custom track may also be updated by
clicking the "Update custom track" button on the track's description page.
The Update Custom Track page provides sections for modifying the track configuration information
(the browser lines and track lines), the annotation data, and the descriptive documentation that
accompanies the track. Existing track configuration lines are displayed in the top "Edit
configuration" text box. In the current implementation of this utility, the existing annotation
data is not displayed. Because of this, the data cannot be incrementally edited through this
interface, but instead must be fully replaced using one of the data entry methods described in
Loading a Custom Track into the Genome Browser. If description text has been
uploaded for the track, it will be displayed in the track documentation edit box, where it may be
edited or completely replaced. Once you have completed your updates, click the Submit button to
upload the new data into the Genome Browser.
If the data or description text for your custom track was originally loaded from a file on your hard
disk or server, you should first edit the file, then reload it from the Update Custom Track page
using the "Browse" button. Note that edits made on this page to description text uploaded
from a file will not be saved to the original file on your computer or server. Because of this, we
recommend that you use the documentation edit box only for changes made to text that was typed or
pasted in.
Browser lines
Browser lines configure the overall display of the Genome Browser window when your annotation file
is uploaded. Each line defines one display attribute. Browser lines consist of the format:
browser attribute_name attribute_value(s)
For example, if the browser line browser position chr22:1-20000
is included in the
annotation file, the Genome Browser window will initially display the first 20000 bases of chr
22.
The following browser line attribute name/value options are available. The value
track_primary_table_name must be set to the name of the primary table on which the
track is based. To identify this table, open up the
Table Browser,
select the correct genome assembly, then select the track name from the
track list. The table list will show the primary table.
Alternatively, the primary table name can be obtained from a mouseover on the
track name in the track control section.
You can also find instructions on how to find this table name in the video
"How do I learn which tables
belong to a data track on the UCSC Genome Browser?".
Note that composite track subtracks are not valid track_primary_table_name values. To find
the symbolic name of a composite track, look in the tableName field in the trackDb
table, or mouse over the track name in the track control section. It is not possible to display only
a subset of the subtracks at this time.
-
position <position> - Determines the part of the genome that the Genome
Browser will initially open to, in chromosome:start-end format.
-
hide all - Hides all annotation tracks except for those listed in the custom
track file.
-
hide <track_primary_table_name(s)> - Hides the listed tracks.
Multiple track names should be space-separated.
-
dense all - Displays all tracks in dense mode. NOTE: Use the "all"
option cautiously. If the browser display includes a large number of tracks or a large position
range, this option may overload your browser's resources and cause an error or timeout.
-
dense <track_primary_table_name(s)> - Displays the specified
tracks in dense mode. Symbolic names must be used. Multiple track names should be
space-separated.
-
pack all - Displays all tracks in pack mode. See NOTE for "dense
all".
- pack <track_primary_table_name(s)> - Displays the specified
tracks in pack mode. Symbolic names must be used. Multiple track names should be
space-separated.
-
squish all - Displays all tracks in squish mode. See NOTE for "dense
all".
-
squish <track_primary_table_name(s)> - Displays the specified
tracks in squish mode. Symbolic names must be used. Multiple track names should be
space-separated.
-
full all - Displays all tracks in full mode. See NOTE for "dense
all".
-
full <track_primary_table_name(s)> - Displays the specified tracks
in full mode. Symbolic names must be used. Multiple track names should be space-separated.
Definition: <track_primary_table_name(s)>. You can find the primary
table name by clicking "View Table Schema" from the track's description page, or from the Table
Browser. It will be listed as the Primary Table. Alternatively, you can mouse-over the track label
in the Browser and look at the URL the link points to. The part after the g= in the URL is the
track's primary table name (e.g., for UCSC Genes you will see g=knownGene in the URL. The track
primary table is knownGene).
Note that the Genome Browser will open to the range defined in the Gateway page search term
box or the position saved as the default unless the browser line position attribute is defined in
the annotation file. Although this attribute is optional, it's recommended that you set this value
in your annotation file to ensure that the track will appear in the display range when it is
uploaded into the Genome Browser.
Track lines
Track lines define the display attributes for all lines in an annotation data set. If more than one
data set is included in the annotation file, each group of data must be preceded by a track line
that describes the display characteristics for that set of data. A track line begins with the word
track
, followed by one or more attribute=value
pairs. Unlike browser
lines - in which each attribute is defined on a separate line - all of the track attributes for a
given set of data are listed on one line with no line breaks. The inadvertent insertion of
a line break into a track line will generate an error when you attempt to upload the annotation
track into the Genome Browser.
The following track line attribute=value pairs are defined in the Genome Browser:
-
name=<track_label> - Defines the track label that will be displayed to
the left of the track in the Genome Browser window, and also the label of the track control at the
bottom of the screen. The name can consist of up to 15 characters, and must be enclosed in quotes
if the text contains spaces. We recommend that the track_label be restricted to alpha-numeric
characters and spaces to avoid potential parsing problems. The default value is "User
Track".
-
description=<center_label> - Defines the center label of the track in
the Genome Browser window. The description can consist of up to 60 characters, and must be
enclosed in quotes if the text contains spaces. The default value is "User Supplied
Track".
-
type=<track_type> - Defines the track type. The track type attribute is
required for BAM,
BED detail,
bedGraph,
bigBed,
bigWig,
broadPeak,
narrowPeak,
Microarray,
VCF and
WIG tracks.
-
visibility=<display_mode> - Defines the initial display mode of the
annotation track. Values for display_mode include: 0 - hide, 1 - dense, 2 - full, 3 -
pack, and 4 - squish. The numerical values or the words can be used, i.e., full mode may be
specified by "2" or "full". The default is "1".
-
color=<RRR,GGG,BBB> - Defines the main color for the annotation track.
The track color consists of three comma-separated RGB values from 0-255. The default value is
0,0,0 (black).
-
itemRgb=On - If this attribute is present and is set to "On", the
Genome Browser will use the RGB value shown in the itemRgb field in each data line of
the associated BED track to determine the display color of the data on that line.
-
colorByStrand=<RRR,GGG,BBB RRR,GGG,BBB> - Sets colors for + and -
strands, in that order. The colors consist of three comma-separated RGB values from 0-255 each.
The default is 0,0,0 0,0,0 (both black).
-
useScore=<use_score> - If this attribute is present and is set to 1,
the score field in each of the track's data lines will be used to determine the level of
shading in which the data is displayed. The track will display in shades of gray unless the
color attribute is set to 100,50,0 (shades of brown) or 0,60,120 (shades of blue). The
default setting for useScore is "0". This table shows the Genome Browser's
translation of BED score values into shades of gray:
shade |
|
|
|
|
|
|
|
|
|
score in range |
≤ 166 |
167-277 |
278-388 |
389-499 |
500-611 |
612-722 |
723-833 |
834-944 |
≥ 945 |
-
group=<group> - Defines the annotation track group in which the custom
track will display in the Genome Browser window. By default, group is set to
"user", which causes custom tracks to display at the top of the track listing in the
group "Custom Tracks". The value for "group" must be the
"name" of one of the predefined track groups. To get a list of allowable group names for
an assembly, go to the table browser and select "group: All Tables" "table:
grp" and "get output" Entries in the "name" column may be used.
(Note that mirrors may define other group names in the grp table.)
-
priority=<priority> - When the group attribute is set, defines
the display position of the track relative to other tracks within the same group in the Genome
Browser window. If group is not set, the priority attribute defines the track's
order relative to other custom tracks displayed in the default group, "user".
-
db=<UCSC_assembly_name> - When set, indicates the specific genome
assembly for which the annotation data is intended; the custom track manager will display an error
if a user attempts to load the track onto a different assembly. Any valid UCSC assembly ID may be
used (eg. hg18, mm8, felCat1, etc.). The default setting is blank, allowing the custom
track to be displayed on any assembly.
-
offset=<offset> - Defines a number to be added to all coordinates in the
annotation track. The default is "0".
-
maxItems=<#> - Defines the maximum number of items the track can
contain. The default value is 250. Be aware that tracks with an extremely large number of items
can cause system instability. The
Kent source
utility bedItemOverlapCount can assist in analyzing base overlap with large tracks.
-
url=<external_url> - Defines a URL for an external link associated with
this track. This URL will be used in the details page for the track. Any "$$"in this
string this will be substituted with the item name. There is no default for this attribute.
-
htmlUrl=<external_url> - Defines a URL for an HTML description page to
be displayed with this track. There is no default for this attribute. A template for a standard
format HTML track description is here.
-
bigDataUrl=<external_url> - Defines a URL to the data file for
BAM,
CRAM,
bigBed,
bigWig or
VCF tracks. This is a required attribute for those
track types. There is no default for this attribute.
Here is an example of a properly formatted track line using the bigBed format, with accompanying
browser line:
browser position chr21:33,031,597-33,041,570
track type=bigBed name="bigBed Example One" description="A bigBed file" bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigBedExample.bb
Sharing your annotation track with others
To make your Genome Browser annotation track viewable by people on other machines or at other sites,
follow the steps below. (Note that some of the URL examples in this section have been broken up into
2 lines for documentation display purposes).
Step 1. Put your formatted annotation file on your web site. Be sure that the file
permissions allow it to be read by others.
Step 2. Construct a URL that will link this annotation file to the Genome Browser.
The URL must contain 3 pieces of information specific to your annotation data:
-
The species or genome assembly on which your annotation data is based. To automatically display
the most recent assembly for a given organism, set the org parameter: e.g.
org=human
. To specify a particular genome assembly for an organism, use the
db parameter, db=database_name
, where database_name is the UCSC
code for the genome assembly. For a list of these codes, see the Genome Browser
FAQ. Examples of this include:
db=hg16 (Human July 2003 assembly), db=mm6 (Mouse Mar. 2005 assembly).
-
The genome position to which the Genome Browser should initially open. This information is of the
form
position=chr_position
, where chr_position is a chromosome number, with
or without a set of coordinates. Examples of this include: position=chr22,
position=chr22:15916196-31832390.
-
The URL of the annotation file on your web site. This information is of the form
hgt.customText=URL
, where URL points to the annotation file on your website.
An example of an annotation file URL is http://genome.ucsc.edu/goldenPath/help/test.bed.
You can add other optional parameters to the URL: (Note: Display may vary if you have conflicting
cart variables, for example having both hide all and highlight features.)
-
hgFind.matches=listOfNames
- highlight features given their names -
example link to highlight two transcripts of the ABO gene
-
<trackName>=full|dense|pack|hide
- show the default tracks adding a track and
set it to full, dense, pack or hide visibility -
example link to show the default or user-selected tracks and set the
Chromosome Bands track to "pack" view. Please note that for this feature to work with
custom tracks you must use their unique assigned name and identifier number
ct_name_####
, only with the full custom track name will this feature work:
ct_name_####=full
-
hideTracks=1
- hide all tracks -
example link to show no tracks at all
-
hideTracks=1&<trackName>=full|dense|pack|hide
- hide all tracks and show
other tracks -
example link to show only the Chromosome Bands track and nothing else
-
hgt.reset=1
- show only the default tracks -
example link
-
hgt.toggleRevCmplDisp=1
- show the reverse-complement -
example link to show the reverse-complement of the ABO gene
-
oligoMatch=pack&hgt.oligoMatch=DNASEQ
- switch on the Short Match track and
highlight a matching sequence -
example link to highlight the TATAWAR motif in the ABO locus
-
highlight=<DB>.<CHROM>:<START>-<END>#<COLOR>|...
-
highlight one or more regions in a given color on the image. Note that the arguments have to be
URL-encoded for Internet browsers, so ":" becomes "%3A", "#"
becomes "%23" and "|" becomes "%7"C. -
example link to highlight two parts of the ABO locus in red and blue.
-
pix=<number>
- set the width of the image in pixels -
example link to create a 300-pixel wide image
-
hgt.labelWidth=<number>
- set the size of the left-side label area -
example link to increase the label area to 50 characters
-
textSize=<number>
- set the size of text font -
example link to increase the text font size to 12 pixels
-
guidelines=on/off
- activate or deactivate the blue guidelines -
example link to switch off blue guidelines
-
enableHighlightingDialog=0/1
- activate or deactivate the highlighting/zoom
dialog - example link to default to zoom mode and switch off the highlight
dialog
If a login and password is required to access data loaded through a URL (e.g., via https:
protocol), this information can be included in the URL using the format
protocol://user:password@server.com/somepath. Only Basic Authentication is supported for HTTP.
Note that passwords included in URLs are not protected. If a password contains a non-alphanumeric
character, such as $, the character must be replaced by the hexadecimal representation for
that character. For example, in the password mypwd$wk, the $ character should be replaced
by %24, resulting in the modified password mypwd%24wk.
For integration into your own website e.g. in an html IFRAME, you can obtain the track image only,
without the rest of the genome browser user interface, by replacing hgTracks in the URL with
hgRenderTracks, like in this example:
http://genome.ucsc.edu/cgi-bin/hgRenderTracks?db=hg19&position=chr9%3A136130563-136150630
Combine the above pieces of information into a URL of the following format (the information
specific to your annotation file is highlighted):
http://genome.ucsc.edu/cgi-bin/hgTracks?org=organism_name&position=chr_position&hgt.customText=URL
Example 10:
The following URL will open up the Genome Browser window to display chr 22 of the latest human
genome assembly and will show the annotation track pointed to by the URL
http://genome.ucsc.edu/goldenPath/help/test.bed:
http://genome.ucsc.edu/cgi-bin/hgTracks?org=human&position=chr22&hgt.customText=http://genome.ucsc.edu/goldenPath/help/test.bed
Step 3. Provide the URL to others. To upload a custom annotation track pointed to
by a URL into the Genome Browser, paste the URL into the large text edit box on the Add Custom
Tracks page, then click the Submit button.
If you'd like to share your annotation track with a broader audience, send the URL for your
track—along with a description of the format, methods, and data used—to the UCSC Genome
mailing list
genome@soe.ucsc.edu.
Example 11:
If you would like to share a URL that your colleague can click on directly, rather than loading it
in the Custom Track tool (as in Example 10), then the URL will need a few extra parameters. Let's
assume that your data is on a server at your institution in one of the large data formats:
bigBed,
bigWig,
BAM,
CRAM, or
VCF.
In this case, the URL must include an hgct_customText
parameter, which
simulates the text box on the Custom Tracks page. Also, the URL must include
the bigDataUrl
that points to the data file on your server.
So, a clickable URL that opens a remote bigBed track for the hg18 assembly to a certain location on
chr21 would look like this:
http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg18&position=chr21:33038447-33041505&hgct_customText
=track%20type=bigBed%20name=myBigBedTrack%20description=%22a%20bigBed%20track%22%20visibility=
full%20bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigBedExample.bb
Custom Tracks can also be shared with others through named sessions. First, upload your tracks as
discussed in the Loading a Custom Track into the Genome Browser section. Then create a named session that includes your custom tracks by navigating to the "Sessions"
page through the "My Data" section in the menu bar. Once there, follow the instructions in the
Creating a Session section of the Sessions help page.
Once you have saved your custom track into a named session, you can share that session with others
by sharing the URL from the "Browser" link or emailing it to them directly by clicking
the "Email" link.
Tip: Multiple tracks can be placed into one custom track submission. To do so,
create a new file that contains the
track lines to each file that will be
included. To submit this custom set of tracks, merely use the URL to this new file.
Troubleshooting annotation display problems
Occasionally users encounter problems when uploading annotation files to the Genome Browser. In
most cases, these problems are caused by errors in the format of the annotation file and can be
tracked down using the information displayed in the error message. This section contains suggestions
for resolving common display problems. If you are still unable to successfully display your
data, please contact
genome@soe.ucsc.edu
for further assistance.
Messages sent to this address will be posted to the moderated genome mailing list, which is
archived on a SEARCHABLE, PUBLIC
Google Groups
forum.
Problem: When I try one of your examples by cutting and pasting it into
the Genome Browser, I get an error message.
Solution: Check that none of the browser lines, track lines, or data lines
in your annotation file contains a line break. If the example contains GFF or GTF data lines, check
that all the fields are tab-separated rather than space-separated.
Problem: When I click the submit button, I get the error message "line 1 of custom input:".
Solution: Check that none of the browser lines, track lines, or data
lines in your annotation file contains a line break. A common source for this problem is the track
line: all of the attribute pairs must on the same line and must not be separated by a line break.
If you are uploading your annotation file by pasting it into the text box on the Genome Browser
Gateway page, check that the cut-and-paste operation did not inadvertently insert unwanted line
feeds into the longer lines.
Problem: When I click the submit button, I get the error message
"line # of custom input: missing = in var/val pair".
Solution: Check for incorrect syntax in the track lines in the annotation
file. Be sure that each track line attribute pair consists of the format
attribute=attribute name.
Problem: When I click the submit button, I get the error message
"line # of custom input: BED chromStarts[i] must be in ascending order".
Solution: This is most likely caused by a logical conflict in the Genome
Browse software. It accepts custom GFF tracks that have multiple "exons" at the same
position, but not BED tracks. Because the browser translates GFF tracks to BED format before
storing the custom track data, GFF tracks with multiple exons will case an error when the BED is
read back in. To work around this problem, remove duplicate lines in the GFF track.
Problem: When I click the submit button, the Genome Browser
track window displays OK, but my track isn't visible.
Solution: Check the browser and track lines in your annotation file to
make sure that you haven't accidentally set the display mode for the track to hide. If you
are using the Annotation File box on the Genome Browser Gateway page to upload the track, check that
you've entered the correct file name. If neither of these is the cause of the problem, try resetting
the Genome Browser to clear any settings that may be preventing the annotation to display. To reset
the Genome Browser, click the Click here to reset link on the Gateway page. If the
annotation track still doesn't display, you may need to clear the cookies in your Internet browser
as well (refer to your Internet browser's documentation for further information).
Problem: I am trying to upload some custom tracks (.gz files) to the
Genome Browser using a URL from a GEO query. However, the upload is failing with the error
"line 1 of .gz: thickStart after thickEnd".
Solution: The custom track mechanism supports plain BED files (not bigBed)
that are of the type broadPeak or
narrowPeak. Set the track attribute
type=<track_type> to enable the loader to correctly process the
special columns at the end of each line. Your track type entry should consist of two lines: the
first to define the track type and the second to specify the URL. For example:
track type=broadPeak
http://www.ncbi.nlm.nih.gov/geosuppl/...
Problem: I've gotten my annotation track to display, but now I can't make
it go away! How do I remove an annotation track from my Genome Browser display?
Solution: To remove only one track, click the Manage Custom
Tracks button and delete the desired track using the checkbox and Delete button. To quickly
remove all of your custom tracks, reset the Genome Browser to its default settings by clicking the
Click here to reset link on the Gateway page. Note that this reset will also remove any
other customizations you have made to your Genome Browser display.
Problem: I put my custom track files on Google Drive and they won't
display in the browser. Why?
OR
Problem: When I try to visualize my custom tracks in the Browser, I
receive the error message "Byte-range request was ignored by server".
Solution: Data servers (such as Google Drive) used to work for hosting
simple text-based custom tracks, but things have changed. For large custom track data sets, the use
of indexed binary formats such as bigBed and bigWig is preferable but never worked with Google Drive
and often fail with other free data providers. These formats provide much faster display performance
because only the portion of the file needed to display the currently viewed region must be
transferred to the Genome Browser server. To allow this type of display, byte-range support must be
enabled on the data server. To check if your server has byte-range requests enabled, issue the
following command:
> curl -I <URL of your file>
In order for your server to host bigBed and bigWig files (or track hubs) for Genome Browser display,
the command output must contain:
> Accept-Ranges: bytes
If you do not receive this output, you may be able to resolve the problem through one of the
following actions:
-
Check with the systems administrators about the configuration of the server. This will often
solve the problem.
-
Find another site with a server that supports byte-ranges.
-
Install an Apache alternative http server such as Cherokee.
Please note that this does not constitute an endorsement by UCSC for using Google Drive to host
your data.
Problem: I used to host files on Dropbox which used to accept byte-range
requests, but I can't get my data to display. Why?
Solution: Dropbox recently changed the ability to stream large amounts of
data making binary files hosted there inaccessible to the browser. If you use Dropbox for smaller
text based track hubs you need to enable the "Public Folder" function on Dropbox, rather
than using the "Share Link" function. For custom tracks that require an associated index
file, the Public Folder approach will allow the Browser to locate the file, whereas the Share Link
feature creates a unique, unassociated link for each file. To enable your Dropbox public folder,
navigate to the following site: https://www.dropbox.com/enable_public_folder. If you are using a free Dropbox
account, note that Dropbox may throttle access to your data to prevent their servers from becoming
overloaded; this may in turn block the Genome Browser's access to the data, preventing the display
of your tracks. Paid Dropbox accounts may not experience this problem. Also, keep in mind that
files in your Dropbox Public Folder are public, and therefore may be indexed by Google. Please note
that this does not constitute an endorsement by UCSC for using Dropbox to host your
data.
Getting started on Track Hubs
Track hubs are web-accessible directories of genomic data that can be viewed on the UCSC Genome
Browser alongside native annotation tracks. Hubs are a useful tool for visualizing a large number
of genome-wide data sets. The Track Hub
utility allows efficient access to data sets from around the world through the familiar Genome
Browser interface. Browser users can display tracks from any public track hub that has been
registered with UCSC. Additionally, users can import data from unlisted hubs or can set up, display,
and share their own track hubs.
For information on using the Track Hub features, refer to the Genome
Browser Track Hub User Guide. For specific information on configuring your trackDb.txt file,
refer to the Track Database Definition Document. See also the
Basic Hub Quick Start Guide and
Quick Start Guide to Organizing Track Hubs into
Groupings.